Primer Design of Sumatran Striped Rabbit (Nesolagus netscheri Schlegel, 1880) using Primer-BLAST and AliView Program
DOI:
10.29303/jbt.v25i1.8499Published:
2025-02-19Downloads
Abstract
The Sumatran striped rabbit (Nesolagus netscheri) lacks specific primers to amplify the chytochrome oxidase 1 (CO1) gene and the chytochrome b (cytb) gene, at present. Therefore, it is important to design primers to amplify the CO1 gene and cytb gene in N. netscheri. The aim of this study is to compare the primer design methods used, namely Primer-BLAST and AliView programs, to design specific primers for the chytochrome oxidase 1 (CO1) and chytochrome b (cytb) genes in N. netscheri. This research was conducted using the descriptive method with molecular observation. In this study, CO1 gene primers, namely [(forward: 5' TGTATGATATGGGGGAGGGC 3'), (reverse: 5' TGGTCCGTCCTTATTACAGCG 3')] and cytochrome b (cytb) gene primers, namely [(forward: CCAGCTCCATCCAATATCTC, (reverse: 5' GTTAGGGTTAGAAGGTCTGC 3')] and showed that primer design using the AliView program produced specific primers in the genus Nesolagus. The conclusion of this study is that primers designed using the AliView program are more specific than those designed using Primer-BLAST.
Keywords:
AliView, primer-BLAST, primer design, sumatran striped rabbitReferences
Aurora, D. A. (2023). DNA barcoding characteristics of Sumatran rabbit (Nesolagus netscheri, Schlegel 1880) (Bachelor’s thesis, Andalas University, Padang). Faculty of Mathematics and Natural Sciences, Andalas University.
Brown, T.A. (2002). Genome. 2nd ed. Oxford: Wiley-Liss.
Chuang, L. Y., Cheng, Y. H., & Yang, C. H. (2013). Specific primer design for the polymerase chain reaction. Biotechnology Letters, 35(10), 1541–1549. https://doi.org/10.1007/s10529-013-1249-8
Dieffenbach, C. W., Lowe, T. M., & Dveksler, G. S. (1993). General concepts for PCR primer design. PCR Methods and Applications, 3(3), S30–S37. https://doi.org/10.1101/gr.3.3.s30
Diss, T. (2003). The polymerase chain reaction. In J. Crocker & G. M. Paul (Eds.), Molecular biology in cellular pathology (pp. 193–210). John Wiley & Sons, Ltd.
Hillis, D. M., Mable, B. K., & Moritz, C. (1996). Applications of molecular systematics: The state of the field and a look to the future. In D. M. Hillis, C. Moritz, & B. K. Mable (Eds.), Molecular systematics (pp. 515–543). Sinauer Associates.
Karp, A., Peter, G. I., & David, S. I. (1998). Molecular tools for screening biodiversity (pp. 112–113). Chapman & Hall.
Koressaar, T., & Remm, M. (2007). Enhancements and modifications of primer design program Primer3. Bioinformatics, 23(10), 1289–1291. https://doi.org/10.1093/bioinformatics/btm091
Larsson, A. (2014). AliView: A fast and lightweight alignment viewer and editor for large datasets. Bioinformatics, 30(22), 3276–3278. https://doi.org/10.1093/bioinformatics/btu531
Lodish, H. A., Berk, S. L., Zipursky, P., Matsudaira, D., Baltimore, D., & Darnell, J. (2000). Molecular cell biology (4th ed.). W. H. Freeman and Company.
Matthee, C. A., Jansen Van Vuuren, B., Bell, D., & Robinson, T. J. (2004). A molecular supermatrix of the rabbits and hares (Leporidae) allows for the identification of five intercontinental exchanges during the Miocene. Systematic Biology, 53(3), 433–447. https://doi.org/10.1080/10635150490445715
McCarthy, J., Holden, J., Martyr, D., and McCarthy, K. (2019). Nesolagus netscheri. The IUCN Red List of Threatened Species 2019: e.T14662A45178557. https://doi.org/10.2305/IUCN.UK.2019-2.RLTS.T14662A45178557.en (Accessed: December 29, 2022).
National Center for Biotechnology Information. (2024). GenBank. Retrieved August 20, 2024, from https://www.ncbi.nlm.nih.gov/nuccore/NC_063946.1/
Priyono, D. S., Rafina, N., Arisuryanti, T., Lesmana, I., Yustian, I., and Setiawan, A. (2025). The first complete mitochondrial genome of Sumatran striped rabbit Nesolagus netscheri (Schlegel, 1880), and its phylogenetic relationship with other Leporidae. Scientific Reports, 15, 2002. https://doi.org/10.1038/s41598-025-85212-x
Regulation of the Minister of Environment and Forestry of the Republic of Indonesia Number P.20/MENLHK/SETJEN/KUM.1/6/2018. (2018). Regulation on types of protected plants and animals. Ministry of Environment and Forestry of the Republic of Indonesia.
Rychlik, W. (1995). Selection of primers for polymerase chain reaction. Molecular Biotechnology, 3(2), 129–134. https://doi.org/10.1007/BF02789108
Roux, K. H. (2009). Optimization and troubleshooting in PCR. Cold Spring Harbor Protocols, 2009(4), pdb.ip66. https://doi.org/10.1101/pdb.ip66
Sambrook, J., & Russell, D. W. (2001). Molecular cloning: A laboratory manual (3rd ed.). Cold Spring Harbor Laboratory Press.
Schlegel, H. (1880). On an anomalous species of hare discovered in the Isle of Sumatra: Lepus netscheri. Notes from the Leyden Museum, 2(2), 59–65.
Setiawan, A., Iqbal, M., Halim, A., Saputra, R., Setiawan, D., & Yustian, I. (2019). First description of an immature Sumatran striped rabbit (Nesolagus netscheri), with special reference to the wildlife trade in South Sumatra. Mammalia, 84, 10.1515/mammalia-2018-0217. https://doi.org/10.1515/mammalia-2018-0217.
Setiawan, A., Iqbal, M., Komarudin, , Saputra, R., Setiawan, D., & Yustian, I. (2018). New reports of the presence and ecology of the Sumatran striped rabbit (Nesolagus netscheri) in South Sumatra. Mammalia, 82, 10.1515/mammalia-2017-0064. https://doi.org/10.1515/mammalia-2017-0064
Surridge, A. K., Timmins, R. J., Hewitt, G. M., & Bell, D. J. (1999). Striped rabbits in Southeast Asia. Nature, 400(6746), 726. https://doi.org/10.1038/23393
Ye, J., Coulouris, G., Zaretskaya, I., et al. (2012). Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics, 13, 134. https://doi.org/10.1186/1471-2105-13-134
Wang, C. (2016). Primer design. Centre for Medical Parasitology, University of Copenhagen.
License
Copyright (c) 2025 Dhea Apriano Aurora, Wilson Novarino, Djong Hon Tjong, Dahelmi Dahelmi, Syaifullah Syaifullah, Arum Setiawan, Dewi Imelda Roesma
This work is licensed under a Creative Commons Attribution 4.0 International License.
Jurnal Biologi Tropis is licensed under a Creative Commons Attribution 4.0 International License.
The copyright of the received article shall be assigned to the author as the owner of the paper. The intended copyright includes the right to publish the article in various forms (including reprints). The journal maintains the publishing rights to the published articles.
Authors are permitted to disseminate published articles by sharing the link/DOI of the article at the journal. Authors are allowed to use their articles for any legal purposes deemed necessary without written permission from the journal with an acknowledgment of initial publication to this journal.
